ck424242 ck424242

26-02-2024
Biology

contestada

fill in with the mRNA strand, then translate to the amino acid sequence using this chart. Remember to always start with the start condon, and end with the stop condon. (Condon = 3 rucleotides) DNA: ATGTTTGCATACCAAGGCTAAATTTTC TRANSCRIPTION: mRNA: pROTEIN (AMINO ACID SEQUENCE): Translation

Respuesta :

Otras preguntas

help please The diameter of a regulation soccer ball is about 8 and three-fifths inches. This number was graphed on a number line? Which point could be the poin

Aaron's teacher assigned each student to a new group. She posted this diagram to help everyone locate their group's tables.Aaron's group sits at coordinates (5,

2. What was the major goal of the Civil Rights Movement?

why was Austria and Prussia ready to invade France ? A they feared a spread of revolution from france to those countries ?

PLEASE ANSWER! 20PTS! What do these two changes have in common? compost rotting boiling sugar to make caramel Select all that apply. A. Both are caused by heati

Temperatures of four liquid substances are shown in the chart. A 2 column table with 4 rows. The first column is labeled substance with entries W, X, Y, Z. The

Easy Question. Will Mark Brainliest Read and choose the correct option with the stem-changing verb in the preterite tense. Ellos ________ (preferir) comprar un

Which of the following statements are correct (select all that is correct) Each antibody is specific to the antigen Antibodies act as signals to tell white bloo

Where was Oliver sent when he was nine years old. why ??

is this relation a function?