letsgivepece1621 letsgivepece1621

22-10-2018
Social Studies

contestada

In 1692 about how many were accused of practicing witchcraft?

Respuesta :

Аноним Аноним

22-10-2018

Over 200 where accused but only 20 executed and 19 out of 20 admitted.

Answer Link

Otras preguntas

Shelton Company has the following account balances at year-end: Accounts receivable $140,000 Allowance for doubtful accounts 7,200 Sales discounts 4,800 She

What is the range of the function y= 2e - 1?

Camille Noah is investing $5,000 in an account that pays an annually compounded rate of 6.75 percent for three years. What is the interest on interest if intere

reply to this with answer Which best proves why the expressions 4 (x + 3) + 2 x and 6 (x + 2) must be equivalent expressions?

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provid

Read the excerpt from "A Quilt of a Country." Once these disparate parts were held together by a common enemy, by the fault lines of world wars and the electrif

Read the excerpt from Iqbal. My first impression was that he was handsome. Then I thought, No, he isn't really good-looking. But he had such eyes. They were swe

Apparels is lndias second largest manufacturer of branded lifestyle apparel the company now plans to diversify into personal care segment by launching perfumes

Identify the graph of the following equation. 2x+5y≥0

Your text describes a study (Bodenhausen, 1990) in which morning people and evening people judged the guilt of students accused of misbehavior in hypothetical s