jpetrik5619 jpetrik5619
  • 22-11-2018
  • Mathematics
contestada

At summer camp the ratio of boys to girls is 5:4. If there are 40 boys, how many girls are there

Respuesta :

Abblez Abblez
  • 22-11-2018

First set up the fractions to compare.

5/4 = 40/x , with x being the number of girls when there are 40 boys

5x = 4*40  = 160 (cross multiplication)

x = 160/5 = 32 (simple algebra simplification)

There are 32 girls.

Answer Link

Otras preguntas

I need help with this please
The amount of green jelly beans in a bag is 25%. If there are 12 green jelly beans, how many total jelly beans are in the bag?
How i can answer this question, NO LINKS, if you answer correctly i will give u brainliest!
3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):
What are your thoughts and feelings about Child Labor?
what do yall think? answer asap please​
how do you write narrative framework
According to your The Hatchet: Brian's Changing Attitudes chart, in Chapter 9, Brian uses the hatchet to __________ 1. cut willows for braces. 2. start a fire.
What should you use to rinse items after cleaning them and before sanitizing them
42. She .. the whole day long. (a) has been working (b) works (c) had worked (d) worked​