ashelikleckley ashelikleckley

24-10-2019
Social Studies

contestada

Telling lots of jokes and using provocative humor can improve the quality of public presentation

True or False

Respuesta :

kelseilee962 kelseilee962

24-10-2019

This is FALSE

provocative:
causing annoyance, anger, or another strong reaction, especially deliberately.

Answer Link

Palestine1999 Palestine1999

24-10-2019

False for sure the answer is

Answer Link

Otras preguntas

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

I Prove that Cos(90-θ)/1+sin(90-θ) +1+sin(90-θ) /cos(90-θ) =2

A survey shows that 67% of peanut butter lovers prefer chunky style. Out of 850 people surveyed hoe many can be predicted to say they prefer chunky style peanut

approximately how long does it take the moon to complete one orbit around earth

Dr potter provides vaccinations against polio and measles. Each polio vaccination multi-dose vial consists of 44 individual doses, and each measles vaccination

10(x+3)=9 mmmmmmmmmmmmmmmmm

how can a driver best be prepare to enter sharp curves

Sharp pain is transmitted through which type of nerve fibers?

Which transition word would a writer use to indicate a conclusion to a text? A: finally B: despite C: although D: however

What is the layer of the earth where mantle convection occurs and on which the earth's crust rests?