helenirby1964 helenirby1964
  • 22-05-2020
  • Chemistry
contestada

4. Translate the following RNA sequence into a protein chain.
AUGGUUACCAGUCGCUUAUAA
Please

Respuesta :

FortniteforLifeooof FortniteforLifeooof
  • 22-05-2020

Answer:

AUUUAAAHAHYAGHY

Explanation:

Answer Link

Otras preguntas

What Is the Function of Tone in Poetry ?
When does James Gatz change his name ? Why ?
What is 7:9 in simplist form
7/8,0.98,8/9 least to greatest
The temperature danger zone is:*
how did harriet bishop impact the future of minnesota
a piece of unglazed porcelain used to test a minerals streak
jenna''s sixth-grade class is taking a bus to the zoo. the zoo is 156 miles from the school. if the bus travels an average of 55 mi/h, how many seconds will it
what is .02439 repeating as a fraction
Is 63ab/7a and 9ab equivalent?