elizabethew03 elizabethew03

22-06-2020
Spanish

contestada

Rolando se parece su
padre, ¿no?--Sí, son iguales.

A. a
B. de
C. con
D. ( no word needed )

Respuesta :

noeliacardero noeliacardero

22-06-2020

Answer:

A

Explanation:

Answer Link

Inerdthoseanswers Inerdthoseanswers

22-06-2020

Answer:

The answers is A cause its a help for the construction of the sentence

Answer Link

Otras preguntas

an investment adviser can give advice on: i nyse listed securities ii options iii commodity futures iv variable annuities

what data did you collect to indicate that the identity of your product was aspirin? what did your results indicate about the purity of the product? g

____ functions may have the same name, as long as their parameter lists are different. A. Only two B. Two or more C. Zero D. Un-prototyped

a. does the speed of the moving object affect the amount of kinetic friction on the object? explain your answer and cite evidence to support your claim.

which of the following is an example of a typical immigrant to the united states between 1865 and 1924?

X 1 2 3 4 5 6 7 8 Y 0,5 0,8 1,2 1,9 3 4,8 7,5 11,9 regresi linear

(Figure: Monopolist) If this monopolist were forced to act like a perfect competitor, it would produce: A) Q1 units and sell it at P1 B) Q2 units and sell it at

FILL IN THE BLANK. typically, methylation of nucleosome n-terminal tails leads to ________.

Here is part of a gene: GTAACCGTATTGCAGCTATTAGCAGCCATG CATTGGCATAACGTCGATAATCGTCGGTAC If the bottom strand of the DNA carries the gene, write the mRNA that woul

Zach scores a ringer 40\%40%40, percent of the time that he throws a horseshoe. Let rrr be the number of throws it takes zach to score his first ringer in a gam