vladimirdelacruzj vladimirdelacruzj

24-09-2020
Social Studies

contestada

Why are the cells called the building blocking of an organism? A:They are visible to the naked eye B:They are made from nonliving materials C:They are the basic unit of life D:They are able to generate new cells.

Respuesta :

hayleycameron hayleycameron

24-09-2020

Answer:

d.they are able to generate new cells

Explanation:

Answer Link

anonyomasgamer0155 anonyomasgamer0155

30-09-2020

Answer: Cells are the bais unit of life

Explanation: because its makes cents.

Answer Link

Otras preguntas

please help me on this question plizzźzzwhat is the green colouring matter found in plants called

4.8 multiplied to 10 to the power -9

Consider the equation -12x+4y=48=0 find the y value and the y intercept of the line.

An account earns 8.4% interest compounded monthly. If 12,000 is invested in the account initially, how much interest is earned in this account over a 25 year pe

Solve the system by graphing. Y=2x-9 y=-2x-1

According to your The Hatchet: Brian's Changing Attitudes chart, in Chapter 9, Brian uses the hatchet to __________ 1. cut willows for braces. 2. start a fire.

7. I wish someone (give) .................. me a job next month.

Miriam has 3 packages of pencils. Each package has 6 pencils. She needs an eraser for each pencil. How many erasers will she need to buy? Tell which OPERATIONS

Kennyhas$893inasavingsaccount.The interest rate is 8 1/5%, compounded annually. To the nearest cent, how much interest will he earn in 5 years?

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):