aerrianabias aerrianabias

23-01-2021
English

contestada

Determine whether the underlined verb in the sentence below is transitive or intransitive. The army marched south in order to evade their enemies. a. Transitive b. Intransitive

Respuesta :

cherylperry676 cherylperry676

23-01-2021

Answer:

The answer is A

Explanation:

Answer Link

Otras preguntas

I need help with this. thank you!

On Monday Harold picked up four donuts and two large coffees for the office staff. He paid 4.08. On Tuesday Melinda picked up two donuts and three large coffees

plot and steps for writing a comedy please!!!

What is one of the main differences between the phosphorus and sulfur cycles? A) Plants absorb phosphorus mainly from the air and sulfur mainly from the soil

What's x² + 2x + 1 factorised?

Consider the following formula used to find the volume of a cone. Which of the following represents the formula that could be used to find the height of the con

Matt had to write 3 4/12 as an improper fraction right how you would tell Matt the easiest way to

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

1) If X = 2, calculate the value of: 2x squared - x 2) if X = -2, calculate the value of: 2x squared -x

Which of the following correctly describes SAM, a biological methylating agent? A) It contains a Cl bonded to a 1° carbon. B) It contains a methyl group bonded