yaboinoodlebread yaboinoodlebread

21-05-2021
Mathematics

contestada

what are the leading coefficient and degree of the polynomial? 3u-5u^6+9u^3.

HELP!

Respuesta :

23-05-2021

Answer:

-5, 6

Step-by-step explanation:

Since 6 is the highest power, it is the degree, and so we also take the coefficient of that term.

Answer Link

Otras preguntas

What does Holden have against bald men?

Look At The Picture. Thats The Question I Need Answered ASAP

which process do scientists think provided earth with an oxygen- rich atmosphere

list the six external parts of a computer system and identify which are output and which and which are input devices

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

. The production of fatty acids is dependent on bicarbonate, but radioactive bicarbonate is not incorporated into the new fatty acid. What could be the reason f

When is cash pulled out of circulation

. A ski club planned a trip to Lake Tahoe, and 40 of the members signed up to go. If this is 60% of the club, how many members does the ski club have in total

how are the four earths systems connected

specificity is important to fitness program because it