IndifferentWave IndifferentWave
  • 23-06-2021
  • English
contestada

what is the subject of the poem In My Mother House?
​

Respuesta :

luckypeaches
luckypeaches luckypeaches
  • 23-06-2021

Answer:

the subject is that it's an authoritave mother & the fear arises from her.

Answer Link

Otras preguntas

if you are given a 2% raise and inflation rate is 3% you are
The SAT mathematics scores in the state of Florida are approximately normally distributed with a mean of 500 and a standard deviation of 100. Using the empiric
How would your study of early China have been different if you were studying 100 years ago?
Can someone help me with this problem... #20
What hormones are related to sodium balance?
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
The radius of the planent venus is nearly the same as that of the earth,but its mass is only eighty percent that of the earth. If an object weighs w on the eart
The spread of ideas during the Renaissance was MOST affected by. A) luthers religious conversion. B) the support of the Catho
what percent of 137.4 is 96
A machine drops 74 milliliters of liquid into a beaker every minute. Using an empty beaker, Sarah started the machine and left the room. When she returned, the