cassidywhvsb cassidywhvsb

21-09-2021
Mathematics

contestada

Which equations represent the same value for t? 1. 2t+5=3t-2 2. t-6=8-t 3. 4t+3.4=2t-11

Respuesta :

ashleyjobt21 ashleyjobt21

28-09-2021

Answer:

h

Step-by-step explanation:

njk

Answer Link

Otras preguntas

If x = 3 and y= -2, then 7x — Зу 2x + y

(w-v)²+2v-7w if w=-4 and v=1

Which of the following functions represents exponential decay and has a y-intercept of 2?

Please complete the following DNA strands 1. AGGTCCAAGCTCAAATTTCCCC 2. GAAACCCCTTAAACCTTAATTCC 3. GCGCGCGCAAATTTTTCCCATCT Please complete the following strands

100 points! Please help asap! Look at the picture attached. My teacher said that both 1 and 2 are neither can someone explain why they are neither? Correct answ

Did the Vikings first attack Ireland in AD 795 ?

*** WILL GIVE BRAINLIST***Pioneer plants begin to grow from coastal sand dunes formed from the tide and wind.Primary, Or secondary succession?? and why

please help asap E ʻike i ka manaʻo like i ka huaʻōlelo "puaʻa" e like me ka mea i hoʻohana ʻia e Chekhov.and then translate it to english the book the bear

find the area of the composite figure, Pre Algebra.

an isosceles right-angled triangle is shown 200cm