dkaur1264gmailcom
dkaur1264gmailcom
21-12-2016
Mathematics
contestada
how to make a graph of(3,2)
Respuesta :
ImANicePerson
ImANicePerson
21-12-2016
You go to 3 on the x-axis and then go up 2. You can just have 1 point
Answer Link
VER TODAS LAS RESPUESTAS ( 77+ )
Otras preguntas
4. PCR Primer design (4 points) You have a piece of DNA that includes the sequence: 5'GATGAGGATGAGGAGAAGTACCGGCCGCCGCCTGCGCATCACAATATGTTCAGT 3' To amplify this
The boundary condition on shear stress at a horizontal interface (the y coordinate is in the vertical direction) of a liquid and gas is given by A. Ugas = 0 B.
Predict the d orbital splitting pattern for a trigonal bipyramidal metal complex ML5 and explain your reasoning.
The IPCC Fifth Assessment Report concludes _______. 1) much uncertainty still remains related to the warming of the climate 2) that while climate change is occu
Which pair of substances does not represent a conjugate acid-base pair? a) CH3NH3 and CH3NH2 b) H2SO3 and HSO4- c) CH3COOH and CH3COO- d) HPO42- and PO43- e) HC
1. Selling price. 2. Pricing strategy. 3. Fixed expenses/costs. 4. Variable expenses/costs. 5. Elastic demand. 6. Inelastic demand. 7. Price fixing. 8. Price sk
A plane flies 400km north and then a further 600km on a bearing of 070°A. how far is the plane now from its starting point?B. on what bearing must the plane fly
The ______ of an organism is How we list the actual alleles that are present, irregardless of expression.
Which of the following is provided by the data dictionary as the database designer begins the process of creating the base relations in the DBMS?a) Data typesb)
Do you think that voting for a third-party is wasting your vote? Lollol whether third-parties are successful and how they might influence the political process
