maurerjoe28 maurerjoe28

25-10-2021
Mathematics

contestada

8/3 * (-2 1/2) the product is

Respuesta :

25-10-2021

Answer:

-28

Step-by-step explanation:

You have to do the parenthesis 1st, then the [tex]\frac{8}{3}[/tex], and multiply the result :D

Answer Link

Otras preguntas

Line is defined as a ______________________ a. a geometric shape that is open and moves from one point to another. b. a slowly curving path along a plane. c. a

What happens when two plates carrying oceanic crust collide

Write the base sequence of the complementary strand of double-helical DNA in which one strand has the sequence (5)ATGCGTAGCCTAGCCTAGTAGCCTTC(3). What is RNA seq

All of the following are examples of correct in line MLA citations except

How can one show physical affection in a healthy way?O writing an encouraging noteO pressuring someone into having sexOcheering for someone in the standsO huggi

There are 10 vehicles in a queue when an attendant opens a toll booth. Vehicles arrive at the booth at a rate of 4 per minute. The attendant opens the booth and

Lashawna is packaging some bulk candy for a sale. The price is $3.98 per pound. Write an equation to model the relationship between the total cost, c, and the

Lydia applied for the salesperson examination in January 2014. She sat for the exam three times in 2014 and four times in 2015. Each time, Lydia did not receive

Cory used his credit card to buy a laptop computer the total cost was $2,090.00. His credit card charge 18% annual interest in one month-that is 1/12 of a year

The height of a trapezoid is 8 inches and its area is 96 inches.One base of the trapezoid is 6 inches longer than the other base.What are the lengths of the bas