amarirogerss24 amarirogerss24

23-02-2022
Mathematics

contestada

George reads 692 pages in a month. Lisa reads twice as many pages as George. Wade reads 45 fewer pages than Lisa. How many pages did the three friends read altogether?

please help

Respuesta :

CerealKidnapper CerealKidnapper

23-02-2022

Answer:

The answer is 2471 I think

Answer Link

itzjustbiscuit itzjustbiscuit

23-02-2022

Answer:

the answer is 2723

Step-by-step explanation:

you add 692 + lizas, which is double the amount, 1384, then you subtract 45 from that and get 1339, then you add them

Answer Link

Otras preguntas

what two Georgians signed the united states constitution

Does old age means end of life according to A Tennyson in Ulysses

---------- is the ability to do an activity for more than a few minutes. What is the blank?

what would you use chromatography for?

how did Thomas Edison contribute to the Industrial Revolution

What the the equation -984-n=-285 what does n equal

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

The election of 1800 demonstrated that the Alien and Sedition Acts were constitutional. the electoral college worked smoothly. the US government was stable. pre

what type of sentence is used to give a command

Identify your human rights violation and explain in a introductory paragraph why you choose the specific human rights