pkb2018 pkb2018

23-01-2017
Biology

contestada

a solution should be___ in order to prevent water gain or loss in a substance
1)hypotonic
2)hypertonic
3)isotonic

Respuesta :

23-01-2017

That would be an isotonic solution

Answer Link

markturley115 markturley115

07-10-2019

Answer:

isotonic

Explanation:

Answer Link

Otras preguntas

The spring constant of Spring A is twice as great as the spring constant of Spring B. Both springs are stretched the same amount. How does the force the Spring

How would a harsh winter most likely affect the rabbit population size?

cuales son los defectos de las mujeres de la biblia

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

Can someone explain and answer this question please... I'm very unsure. please and thankyou

Solve for percent error: At a school production, the drama club advisor predicted that there would be 200 people on the first night. Find the percent error if 2

plss help me with this:(((

What are two ways that the legislative branch checks the executive branch in the selection of judicial appointees? The Senate Judiciary interviews judicial appo

Its a project, but please answer them correctly ⦁ What is the issue Twain is satirizing? ⦁ What techniques does Twain use to create his satire? ⦁ What is the

Two students are exploring a creek in their neighborhood. The students hope to find some fossils along the way. What kinds of rocks should the students look fo