Both karen and bob are out of work. karen applies to a few jobs each week, but does not particularly care to be employed. bob was avidly searching for a job, but a little over a month ago he gave up searching. who would be counted as unemployed by the current population survey (cps)

Question

21-06-2022
Business

contestada

Both karen and bob are out of work. karen applies to a few jobs each week, but does not particularly care to be employed. bob was avidly searching for a job, but a little over a month ago he gave up searching. who would be counted as unemployed by the current population survey (cps)

Respuesta :

Otras preguntas

Use the following DNA sequences and transcribe each into mRNA. ATACCGATACGGACTTCATCGGATACGCGCCGGATCCAGTCACTA(I Have 3,000 points and will give brainliest and I

A car is driving at 45 kilometers per hour. How far, in meters, does it travel in 5 seconds?

The demand and supply functions for bikes are

Quill The birds are chirping. Their chirping wakes up the tiger.

help me please show your solution

EXPLAIN a Complete the table below to explain why each problem was such a concern for Elizabeth. Problem Succession Religion Foreign policy Taxation Ireland Mar

What is the recursive formula for the perimeter of a square of side n(the nth perimeter) using the first number(perimeter) in the pattern?

Describe the various dimensions of health.

Observations are not made with our eyes alone. Explain how you can use: i.Your sense of smell to tell that someone is cooking. ii.Your sense of touch to learn m

What are the factors that society should take into account when weighing the costs and benefits of regulating a product— such as marijuana, alcohol, and tobacco

nikitavidya0 nikitavidya0 · Answer 1 · 2022-06-30T13:47:32+02:00

According to the current population survey, Bob situation will be counted in the unemployment survey.

What is Unemployment?

Unemployment refers to the situation in which the person is willing to work but he or she is unable to find the appropriate job.

In the given scenario, Karen is unwilling to work as he does care about getting a job. However, Bob is willing to work and all very stressed about not getting the job.

All members of a household who are of working age are asked about their demographics and job status as part of the Current Population Survey (CPS).

Learn more about unemployment here:

https://brainly.com/question/13605812

#SPJ1