florharlevyshine florharlevyshine

26-02-2017
Mathematics

contestada

A truncated right triangular prism has how many sides

Respuesta :

26-02-2017

well i know that it has 5 faces and six vertices, dont know about the last thing sorry

Answer Link

Otras preguntas

Dirctions Johnny's last words dying words are to tall Ponyboy stay gold Consider and determinw what Johnny most likey means by this Compose a shourt response in

value is defined as a personal assessment of the net worth that an individual obtains from making a purchase.

what do you do if your trying to use wires for your cart and the hole in the middle coes all the way through

Energy problem formulas Potential Energy = mgh v = velocity or speed Kinetic energy = mv² 9 = 9.8 m/s² m = mass in kg (Precision of 1) h = height in meters You

Which of the strands of DNA could act as a primer for the DNA sequence shown below? 5 ' CCCTGGGCTCTGTAAATGTTTCTAAGTG -3' 3' GGGACCCGAGACATTTACAAAGATTCAC -5' A:

Uk sepatu= 36,37,38,39,40,41,42,43,44,45 Banyak sepatu=2,4,3,6,5,12,15,10,8,3 Tentukan ukuran persajian data(mean,median,modus)

An aqueous solution contains 0.20 M ammonia. One liter of this solution could be converted into a buffer by the addition of: (Assume that the volume remains con

(a) An angle measures 36°. What is the measure of its complement? (b) An angle measures 79°. What is the measure of its supplement?

Exam: 04.01 Synthesizing Information Question 4 (Essay Worth 10 points) (04.01 MC) In this lesson, you selected one of two prompts to write a fully developed es

What happens if programmer does not use tools. before programming?