ndurairajownkpq ndurairajownkpq

22-09-2017
Mathematics

contestada

Temperatures in the Gobi Desert reach -40F in the winter and 90F in the summer. Find the range of the temperatures.

Respuesta :

22-09-2017

The range is the highest number - lowest number
90F - 40F = 50F

Answer Link

Otras preguntas

Which river is represented by the red line on this map?.

Question about finding intercepts from a table. Hope someone can answer!

I need help. I have to find X to solve the equation.

In which one element replaces a similar element in a compound

Question 10 of 20 : Select the best answer for the question 10. What is the purpose of the introduction in an essay? A. To focus on current statistics B. To hig

Cancer is subject to evolution due to: Question 25 options: A) Gene flow B) Tumor cells experiencing a bottleneck event due to chemotherapy C) Natural selection

3.Original DNA sequence: 3' TACCGCTTACGTCTGATCGCT 5' Mutated DNA sequence: 3' TACCGCTTATTATTACGTGCTGCTATCGCT 5' Type of mutation (3pts): Amino acid ( 3pts):

The graph shows y as a function of x: Graph of x against y shows 4 segments. Segment A is a horizontal line parallel to the x-axis. Segment B is a slanting stra

which statement about tuition is the most accurate?

graph it pleaseeeeeeeeeeeeeeeeeeeeeeeeeeee