swaia3711 swaia3711

25-01-2018
Spanish

contestada

Which of the following main clauses indicates that the subordinate second clause will need to be in the subjunctive? Yo creo que... Pienso que... Es dudoso que... Es cierto que...

Respuesta :

Flowerly Flowerly

25-01-2018

Hey there!

Which of the following main clauses indicates that the subordinate second clause will need to be in the subjunctive?

Answer:
Es dudoso que

Hope this helps
Have a great day (:

Answer Link

sarah132323 sarah132323

18-03-2022

Answer:

es dudoso que

Explanation:

I speak Spanish!

Answer Link

Otras preguntas

Why does Vivien say that she “shan't tell” Lancelot’s identity to her friend in King Arthur's Socks: A Comedy in One Act?

Where does the water in streams and rivers originate? a. precipitation b. runoff c. ice and snowpacks d. all of the above

in a beauty contest, half of the judges voted for miss.a .2\3 of them voted for miss.b., 10 voted for both and 6 did not vote for either miss.a or miss.b.find h

Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC

How is the location of an electron described?

What does the equation -355-n=-957 what does n equal?

why can't the position of an electron be determined with certainty?

While the signalman is describing the actions of the person he sees by the mouth of the tunnel, the narrator says in his mind. "for God's sake clear the way!" w

The shift from agriculture to industrialization illustrates that __________. A. land has become scarce B. economies change over time C. society has become more

a solution of 0.10 hydrochloric acid, HCL is a better conductor of electricity than 0.10 M acetic acid, CH3COOH. sketch the ions and molecules in both solutions