cvillmure
cvillmure cvillmure
  • 22-01-2016
  • Social Studies
contestada

why were the slaves jobs in each region different

Respuesta :

mike1973 mike1973
  • 22-01-2016
Say if you had one flat area and no rocks good soil good for cotton but if you where on a shore like a beach it's harder to go row so tobacco is a good crop there. 
Answer Link
Smartcookie24
Smartcookie24 Smartcookie24
  • 23-01-2016
Because some regions or colonies had different climates ( weather ).
Answer Link

Otras preguntas

Suppose scientists found parts of the DNA from a dinosaur. What info would this discovery provide? What info would it not give them?
what mass of iron 3 chloride contain 2.35 x 10 to the 23rd chloride ions
Allergies are the most common type of immune system disorder. Describe an allergic reacion and explain why it may be harmful. (5 marks)
Consider the following sequence of genomic DNA which is a template strand containing the beginning of the open reading frame for a gene. 3'TAAACTGTACAGGGCCATAAC
Which of the following can increase your credit cards APR
Please I need help quickly I'm on a time limit
1+4=5 2+5=12 3+6=21 8+11=?
Which of the following can increase your credit cards APR
This is Super Confusing to me
Click ___ to move a stacked object to the top of the stack.