aleenrose3632 aleenrose3632

23-03-2018
Biology

contestada

What gene does aacgaagaggacatagagtatctaccgaaaaacaatcccgaaggaccgttacaacactcgatcaaccgcaagaaagtacgatggcaacatccattgtgtatgcatccatatctcatccagcattctgaaagggtaatgaataattattccgctgagttcatgaggtatccgaaggaggagcaacacttaggctataagagtatcatgcacatagatcgggataaatcgcctatcatatgtgacaacaatttcatgattaaaagt code for?

Respuesta :

NAWty12345 NAWty12345

28-03-2018

A gene instructs for the making of protein molecules.
Please make brainliest!☺

Answer Link

Otras preguntas

Which words in the sentence are the main and auxiliary verbs? He might not eat all of his dinner tonight. A. might eat B. not eat C. might not eat

If f(x) = 4 – x2 and g(x) = 6x, which expression is equivalent to (g – f)(3)?

A running track is1/3 of a kilometre. What is the total distance a runner travels if he goes four times around track

The indentation style used on a Works Cited page is called

which of the following events happens first in the development of a new organism

why did britain withdraw from the palestine mandate in 1947

Which material will refract light the least? n = 1.72 n = 2.34 n = 1.58 n = 1.92 I think the answer is n = 1.58 but I need to know why a low inde

seven twelves of 840 students went to a spring concert. how many did not go

How is the sun related to nuclear electromagnetic and heat energy? please answer I need it before monday

The diagram below shows the location of three stars in space. The light from Star 2 reaches Star 1 in 63 years. If Star 3 is 75 light years from Star 2, which o